Assessing Non-synonymous Single Nucleotide Polymorphism of IGF-1 Gene Sequence in Three Nigerian Local Chicken Strains

L. J., Isaac, and B., Okon, and L. A., Ibom, (2024) Assessing Non-synonymous Single Nucleotide Polymorphism of IGF-1 Gene Sequence in Three Nigerian Local Chicken Strains. Asian Journal of Research in Biosciences, 6 (2). pp. 250-256.

[thumbnail of Isaac622024AJORIB1759.pdf] Text
Isaac622024AJORIB1759.pdf - Published Version

Download (415kB)

Abstract

Local chicken strains – normal feathered, frizzle feathered and naked neck – were used in this study to assess the single nucleotide polymorphism of insulin like growth factor -1 (IGF-1) gene. A total of sixty (60) chickens (twenty (20) from each strain, from which fifteen (15) - five (5) was sampled per strain for blood collection and DNA extraction) were involved in the work. Jena Bioscience Gmbh preparation kit was used in extracting DNA, while the Shine Gene Primers given by:

GTCGGGCTACTTGAGTTACTAC – Forward.

TTGCGCAGGCTCTATCTGCTC - Reverse.

was used to identify genomic DNA for sequencing of the gene (IGF-1). 2% agarose gel was used to assess the DNA purity. Results showed the polymorphism of IGF-1 gene in these strains with the neutral (beneficial) variants being more predominant and as such the tendency to influence the expression of more traits. Thus, making IGF-1 a marker of interest in the genomic selection of chicken for development and improvement.

Item Type: Article
Subjects: Article Archives > Biological Science
Depositing User: Unnamed user with email support@articlearchives.org
Date Deposited: 26 Nov 2024 09:41
Last Modified: 05 Nov 2025 03:48
URI: http://community.sent2promo.com/id/eprint/2250

Actions (login required)

View Item
View Item